Digibron cookies

Voor optimale prestaties van de website gebruiken wij cookies. Overeenstemmig met de EU GDPR kunt u kiezen welke cookies u wilt toestaan.

Noodzakelijke en wettelijk toegestane cookies

Noodzakelijke en wettelijk toegestane cookies zijn verplicht om de basisfunctionaliteit van Digibron te kunnen gebruiken.

Optionele cookies

Onderstaande cookies zijn optioneel, maar verbeteren uw ervaring van Digibron.

Bekijk het origineel

DNA: de taal van het leven

Bekijk het origineel

PDF Bekijken
+ Meer informatie

DNA: de taal van het leven

3 minuten leestijd

Hoeveel planten, dieren en mensen van elkaar ook mogen verschillen, ze hebben alle één belangrijke overeenkomst: ze zijn opgebouwd uit cellen. Die cellen hebben een kern. In de kern bevindt zich het 'recept' van het desbetreffende organisme.

Het 'recept' is geschreven in DNA. DNA is te vergelijken met een uiterst dunne, lange draad. Bij de mens is de lengte van het totale DNA in één kern ongeveer 2,50 m. Bedenk daarbij dat de kern zelf nauwelijks eenduizendste millimeter groot is.

Het DNA is verdeeld over 46 draadvormige deeltjes: de chromosomen. De helft (23) van die chromosomen (en dus van het DNA) is afkomstig van de zaadcel en de andere helft van de eicel.

Een ketting

Om iets van de taal van het DNA te begrijpen, stellen we het DNA voor als een ketting van kralen in vier kleuren. De volgorde van de kleuren bepaalt de betekenis.

Volgorde die de betekenis bepaalt, kennen we al. Neem bijvoorbeeld getallen. Met vier cijfers, 1, 2, 3 en 4, zijn verschillende getallen te vormen: 1234, 1243, 1324, enzovoorts. Ook bij letters is de betekenis afhankelijk van de volgorde. Van vier letters, A, K, L en S, maak je onder meer KLAS, SLAK en ALSK.

De vier 'kleuren' van het DNA worden weergegeven met A, C, G en T. Bijvoorbeeld: GGAATTGCTGAAGAATGTTG TACCAGTATATGTACTCTGTATCA GCTCGAC. De reeks van het totale DNA van een menselijke cel bedraagt (2x) 3 miljard. Zo uitgeschreven vult deze code zo'n (2x) 1000 forse boeken. Het 'recept' van een mens is bepaald geen peulenschil. In de cel wordt het DNA vertaald in eiwitten. Voor een eiwit is een stuk DNA nodig van ongeveer 1000 'kralen'. Zo'n stuk het een gen (in het meervoud: genen).

Insuline

Het DNA van een kern bevat bij de mens 2 x 80.000 genen. Elk gen hebben we dubbel: één geërfd van pa en één van ma. De genen liggen verspreid over de verschillende chromosomen.

De kennis van het DNA is in de laatste decennia enorm toegenomen. De 2 x 23 chromosomen zijn genummerd naar lengte. Het langste chromosoom is nr.1. Daarvan hebben we er in elke celkern 2. In een hoog tempo probeert de wetenschap de geheimtaal van het DNA te ontcijferen.

Een belangrijke vraag daarbij is op welk chromosoom bepaalde genen liggen. Zo heeft men ontdekt dat het gen voor de resusfactor op het eerste chromosoom ligt. Het gen voor insuline bevindt zich op het elfde chromosoom.

Niet alleen de kennis, maar ook de techniek is enorm toegenomen. In 1983 kwam de Amerikaans firma Eli Lilly met een nieuwe vorm van insuline op de markt. In het laboratorium had men uit menselijk DNA het gen voor insuline geknipt. Datzelfde gen werd vermenigvuldigd en in het DNA van een bacterie ingebouwd. Het resultaat was een bacterie die in grote hoeveelheden menselijk insuline produceert. De insuline kan gebruikt worden voor diabetespatiënten.

Lilliputters

Op dezelfde manier kan men ook menselijk groeihormoon produceren. Met dat hormoon kunnen jonge lilliputters behandeld worden, zodat hun lichaam tot normale grootte uitgroeit. Voor dit geknutsel met DNA zijn verschillende aanduidingen. Netjes heet het moderne biotechnologie, wat denigrerend heet het genetische manipulatie. Wat men er ook van denkt, met de gevolgen ervan zullen we steeds meer te maken krijgen.

Dit artikel werd u aangeboden door: Reformatorisch Dagblad

Deze tekst is geautomatiseerd gemaakt en kan nog fouten bevatten. Digibron werkt voortdurend aan correctie. Klik voor het origineel door naar de pdf. Voor opmerkingen, vragen, informatie: contact.

Op Digibron -en alle daarin opgenomen content- is het databankrecht van toepassing. Gebruiksvoorwaarden. Data protection law applies to Digibron and the content of this database. Terms of use.

Bekijk de hele uitgave van vrijdag 23 januari 1998

Reformatorisch Dagblad | 32 Pagina's

DNA: de taal van het leven

Bekijk de hele uitgave van vrijdag 23 januari 1998

Reformatorisch Dagblad | 32 Pagina's

PDF Bekijken